Manatees 0 comments Details Genus:Trichechus Species:spp. Common Name:Manatees Genbank Taxid: Group:Mammal Habitat:fresh and marine Status:endangered/threatened Gene Region:CYTB Fragment Length:69 qPCR Chemistry:Probe Forward Primer:CGCTAACCGCATTCTCTTCAG Reverse Primer:GGTAGCGAATGATYCAACCATAGTT Probe:CCCACATTTGCCGAGAC PCR Efficiency:95.25 R2: Limit of Detection:13 copies /μL Limit of Quantification:N/A Journal:Endangered Species Research Source: http://www.int-res.com/abstracts/esr/v35/p101-111/ Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
