Details

Genus:

Trichechus

Species:

spp.

Common Name:

Manatees

Genbank Taxid:

Group:

Mammal

Habitat:

fresh and marine

Status:

endangered/threatened

Gene Region:

CYTB

Fragment Length:

69

qPCR Chemistry:

Probe

Forward Primer:

CGCTAACCGCATTCTCTTCAG

Reverse Primer:

GGTAGCGAATGATYCAACCATAGTT

Probe:

CCCACATTTGCCGAGAC

PCR Efficiency:

95.25

R2:

Limit of Detection:

13 copies /ΞΌL

Limit of Quantification:

N/A

Journal:

Endangered Species Research