Mink frog 0 comments Details Genus:Lithobates Species:septentrionalis Common Name:Mink frog Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:100 qPCR Chemistry:Probe Forward Primer:ACCATCCTCAACCACACAATACC Reverse Primer:TCCGGCAGCTAAGAC TGGAAACAATACC Probe:TATTCGTCTGGTCAG TTT TACAATACC PCR Efficiency:107.13 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
