Mozambique tilapia Details Genus:Oreochromis Species:mossambicus Common Name:Mozambique tilapia Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:16S Fragment Length:189 qPCR Chemistry:Dye Forward Primer:CTTCAGACGCCAGAACAG Reverse Primer:GCTTGGAGTTGTAACTCTGG Probe:N/A PCR Efficiency:R^2 values: 0.98187 to 0.99999; efficiencies ranged from 0.94 to 1.21 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://onlinelibrary.wiley.com/doi/full/10.1111/1755-0998.12505 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast