N/A 0 comments Details Genus:Opisthorchis Species:viverrini Common Name:N/A Genbank Taxid: Group:Parasite Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:138 qPCR Chemistry:Probe Forward Primer:GGTGGTTTGGGCTCATCATA Reverse Primer:GAAC CCAA CTAT CCAC CACA TAAGGGCTCATCATA Probe:OV-COI-P (5-FAM- TAGCT CGGTT ACTAT GATTA T -NFQ-MGB-3),GGGCTCATCATA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Elsevier Source: http://dx.doi.org/10.1016/j.actatropica.2017.01.008 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
