noble crayfish Details Genus:Astacus Species:astacus Common Name:noble crayfish Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:65 qPCR Chemistry:Probe Forward Primer:GATTAGAGGAATAGTAGAGAG Reverse Primer:CTGATGCTAAAGGGGGATAA Probe:Fam-AGGAGTAGGGACAGGATGAACT-BHQ-1 PCR Efficiency:97.4 R2: Limit of Detection:5/PCR Limit of Quantification:5/PCR or 10/PCR dependent on approach Journal:PLOS One Source: https://doi.org/10.1371/journal.pone.0179261 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast