North African catFish 0 comments Details Genus:Clarias Species:gariepinus Common Name:North African catFish Genbank Taxid: Group:Fish Habitat:freshwater Status:invasive Gene Region:COI Fragment Length:141 qPCR Chemistry:Conventional PCR Forward Primer:GGAGCCCTTTTAGGAGACGA Reverse Primer:ATCAGGAGCCCCTAGCATT Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Biochemical Systematics and Ecology Source: https://doi.org/10.1016/j.bse.2014.05.003 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.