North American Green Sturgeon 0 comments Details Genus:Acipenser Species:medirostris Common Name:North American Green Sturgeon Genbank Taxid: Group:Fish Habitat:Freshwater/Saltwater Status:Native/Threatened Gene Region:COI Fragment Length:<150 qPCR Chemistry:Probe Forward Primer:AGGGAAAAAATGGTTAGGTCTACAGA Reverse Primer:CCCCACTGGCGGGAAA Probe:CTCCCGCATGGGCTA PCR Efficiency:94 R2: Limit of Detection:0.013 pg/μL Limit of Quantification:N/A Journal:Journal of Fish and Wildlife Management Source: https://doi.org/10.3996/012018-JFWM-006 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.