North American river otters 0 comments Details Genus:Lontra Species:canadensis Common Name:North American river otters Genbank Taxid: Group:Mammal Habitat:marine Status:N/A Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:CCTAGCCCTAGCCCTCTCCA Reverse Primer:CCGCCGATTCATGTTAAGGT Probe:ACCTCGAAACAACGGG PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-015-0511-x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
