oriental weatherloach 0 comments Details Genus:Misgurnus Species:anguillicaudatus Common Name:oriental weatherloach Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status: Gene Region:12S Fragment Length:93 qPCR Chemistry:Probe Forward Primer:GTAGCGAACGAAGTGGGAAGA Reverse Primer:AAATCCTCCTTCGAGCACTAAGTTT Probe:ATGGGCTACATTTTCT PCR Efficiency:86–101% R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS ONE Source: https://doi.org/10.1371/journal.pone.0179251 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.