Patch-nosed salamander 0 comments Details Genus:Urspelerpes Species:brucei Common Name:Patch-nosed salamander Genbank Taxid: Group:Amphibian Habitat:freshwater Status:native Gene Region:CYTB Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:CGATACCGCCTCAGCCTTT Reverse Primer:CTCCGTTAGCGTGGGTGTT Probe:TTCAGTAGCCCACATCTGTCGTGA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Copeia Source: http://www.bioone.org/doi/10.1643/CH-14-202 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
