pearl mussel 0 comments Details Genus:Margaritifera Species:margaritifera Common Name:pearl mussel Genbank Taxid: Group:Mollusk Habitat:freshwater Status:endangered/threatened Gene Region:COI Fragment Length:83 qPCR Chemistry:Probe Forward Primer:TTGTTGATTCGTGCTGAGTTAGG Reverse Primer:GCATGAGCCGTAACAATAACATTG Probe:CCTGGTTCTTTGCTGGGT PCR Efficiency:N/A R2: Limit of Detection:0.78pg Limit of Quantification:7.8pg Journal:Scientific Reports Source: https://doi.org/10.1038/s41598-018-37001-y Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
