rainbow trout 0 comments Details Genus:Oncorhynchus Species:mykiss Common Name:rainbow trout Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:ND1 Fragment Length:102 qPCR Chemistry:Probe Forward Primer:AGTCTCTCCCTGTATATCGTC Reverse Primer:GATTTAGTTCATGAAGTTGCGTGAGTA Probe:CCAACAACTCTTTAACCATC PCR Efficiency:95.9 R2: Limit of Detection:10 mtDNA copies/rxn Limit of Quantification:N/A Journal:Parasites & Vectors Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5987472 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.