Rainbow Trout/Steelhead 0 comments Details Genus:Oncorhynchus Species:mykiss Common Name:Rainbow Trout/Steelhead Genbank Taxid: Group:Fish Habitat:Brackish Status:Native Gene Region:COI Fragment Length:<150 qPCR Chemistry:Probe Forward Primer:AACATAAAACCTCCAGCCATCTCT Reverse Primer:AGCACGGCTCAAACGAAAA Probe:Probe-AGTACCAAACCCCC PCR Efficiency:92.4 R2: Limit of Detection:3.2 pg/μL Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12305 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
