Red-spotted newt (eastern) 0 comments Details Genus:Notophthalmus Species:viridescens Common Name:Red-spotted newt (eastern) Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Native Gene Region:COI Fragment Length:86 qPCR Chemistry:Probe Forward Primer:GTACTTGCAGCAGGTATTACAATGC Reverse Primer:ACAGGGTCTCCTCCT CCAGCATTACAATGC Probe:ACAGATCGAAATCTA AACATTACAATGC PCR Efficiency:113.64 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-017-0962-3 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
