Red Swamp Crayfish Details Genus:Procambarus Species:clarkii Common Name:Red Swamp Crayfish Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:65 qPCR Chemistry:Probe Forward Primer:AACTAGGGGTATAGTTGAGAG Reverse Primer:CAGAAGCTAAAGGAGGATAA Probe:AGGAGTTGGAACAGGATGGACT PCR Efficiency:N/A R2: Limit of Detection:10^(-8) ng/ul Limit of Quantification:10^(-4) ng/ul Journal:Journal of Applied Ecology Source: https://besjournals.onlinelibrary.wiley.com/doi/full/10.1111/1365-2664.12262 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast