River herring 0 comments Details Genus:Alosa Species:psuedoharengus Common Name:River herring Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:endangered/threatened Gene Region:COI Fragment Length:≈50 qPCR Chemistry:Probe Forward Primer:ATGAGCTTCTGACTACTT Reverse Primer:GATAGTTAGATCGACGGA Probe:CGCGATCGGATGAACAGTCTACCCGCCCTTGATCGCG PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS ONE Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0205578 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
