Rocky mountain tailed frog 0 comments Details Genus:Ascaphus Species:montanus Common Name:Rocky mountain tailed frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:native Gene Region:CYTB Fragment Length:90 qPCR Chemistry:Probe Forward Primer:ACGTCAACTATGGCTGGCTAATC Reverse Primer:GTCCTCGGCCAATGTGAAGA Probe:CATGCAAATGGAGCATC PCR Efficiency:118 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Canadian Journal of Fisheries and Aquatic Sciences Source: http://www.nrcresearchpress.com/doi/abs/10.1139/cjfas-2013-0047 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
