Rocky Mountain tailed frog Details Genus:Ascaphus Species:montanus Common Name:Rocky Mountain tailed frog Genbank Taxid: Group:Amphibian Habitat:freshwater Status:native Gene Region:CYTB Fragment Length:85 qPCR Chemistry:Conventional PCR Forward Primer:CGTCAACTATGGCTGGCTAA Reverse Primer:TCG GCC AAT GTG AAG ATA AACAACTATGGCTGGCTAA Probe:CAACTATGGCTGGCTAA PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLOS ONE Source: https://doi.org/10.1371/journal.pone.0022746 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast