round goby 0 comments Details Genus:Neogobius Species:melanostomus Common Name:round goby Genbank Taxid: Group:Fish Habitat:Freshwater/Brackish Status:Invasive Gene Region:CYTB Fragment Length:85 qPCR Chemistry:Dye Forward Primer:CTATGTGATGATCGGACAGC Reverse Primer:GTTCTCTAGTCAGCTCGCT Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0147558 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.