Details

Genus:

Neogobius

Species:

melanostomus

Common Name:

round goby

Genbank Taxid:

Group:

Fish

Habitat:

marine/brackish/freshwater

Status:

invasive

Gene Region:

COI

Fragment Length:

149

qPCR Chemistry:

Probe

Forward Primer:

CTTCTGGCCTCCTCTGGTGTTG

Reverse Primer:

CCCTAGAATTGAGGAAATGCCGG

Probe:

CAGGCAACTTGGCACATGCAG

PCR Efficiency:

89โ€“101%

R2:

Limit of Detection:

N/A

Limit of Quantification:

Cq = 38

Journal:

PLoS ONE