rusty crayfish 0 comments Details Genus:Orconectes Species:rusticus Common Name:rusty crayfish Genbank Taxid: Group:Arthropod Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:128 qPCR Chemistry:Dye Forward Primer:CAGGGGCGTCAGTAGATTTAGGTAT Reverse Primer:CATTCGATCTATAGTCATTCCCGTAG Probe:N/A PCR Efficiency:0.95-1.05 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Journal of Applied Ecology Source: https://doi.org/10.1111/1365-2664.12621 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
