Sakhalin taimen 0 comments Details Genus:Parahucho Species:perryi Common Name:Sakhalin taimen Genbank Taxid: Group:Fish Habitat:marine/brackish/freshwater Status:endangered/threatened Gene Region:ND2 Fragment Length:124 qPCR Chemistry:Probe Forward Primer:GCAATAGGCCTCCTATCAACAA Reverse Primer:CGAATTGTAAAATTAGTACTATCCATCCA Probe:AGCATACTCTTCAATCGCCCACCT PCR Efficiency:N/A R2: Limit of Detection:0.95 copies 2 μl−1 Limit of Quantification:N/A Journal:Limnology Source: http://link.springer.com/10.1007/s10201-017-0535-x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
