Saprolegniaceae (family) 0 comments Details Genus:Aphanomyces Species:astaci Common Name:Saprolegniaceae (family) Genbank Taxid: Group:other Habitat:Freshwater Status:N/A Gene Region:ITS-1 Fragment Length:59 qPCR Chemistry:Probe Forward Primer:AAGGCTTGTGCTGGGATGTT Reverse Primer:CTTCTTGCGAAACCTTCTGCTA Probe:TTCGGGACGACCC PCR Efficiency:N/A R2: Limit of Detection:5 PCR forming units Limit of Quantification:50 PCR forming units Journal:Veterinary Microbiology Source: https://www.sciencedirect.com/science/article/pii/S0378113508006081?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
