sea nettles 0 comments Details Genus:Chrysaora Species:quinquecirrha Common Name:sea nettles Genbank Taxid: Group:jellyFish Habitat:marine Status:N/A Gene Region:16S Fragment Length:298 qPCR Chemistry:Dye Forward Primer:TGTCACCTAATTAGTGAATGGT Reverse Primer:CCCAACCAAACTGTCTTACT Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:1000 copies/μl Limit of Quantification:N/A Journal:Journal of Coastal Research Source: https://doi.org/10.2112/SI78-014.1 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
