silver carp 0 comments Details Genus:Hypophthalmichthys Species:molitrix Common Name:silver carp Genbank Taxid: Group:Fish Habitat:Freshwater Status:Invasive Gene Region:COI Fragment Length:96 qPCR Chemistry:Probe Forward Primer:CGCAGGAGCATCCGTAGAC Reverse Primer:TTAATAGTTGTGGTGATGAAGTTAATTGC Probe:TTCTCTCTTCACCTAGCAG PCR Efficiency:98.53 R2: Limit of Detection:1 target copy per reaction Limit of Quantification:N/A Journal:Journal of Great Lakes Research Source: https://www.sciencedirect.com/science/article/pii/S0380133017300874?casa_token=F8adBjQFZBMAAAAA:Jw_mIpSYaen1qUv6Zkc7-eJUy3Z_hInwX4SQKc4RLu43fJL8FPJ98aNgN-JkbCpB8W8O6MdU Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
