silver carp 0 comments Details Genus:Hypophthalmichthys Species:molitrix Common Name:silver carp Genbank Taxid: Group:Fish Habitat:freshwater/brackish Status:invasive Gene Region:D-loop Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:GGTGGCGCAGAATGAACTA Reverse Primer:TCACATCATTTAACCAGATGCC Probe:CCATGTCCGTGAGATTCCAAGCC PCR Efficiency:88.4% - 107.7% R2: Limit of Detection:20 copies per reaction Limit of Quantification:N/A Journal:Biological Conservation Source: https://doi.org/10.1016/j.biocon.2014.11.020 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
