sister taxa sauger Details Genus:Sander Species:canadensis Common Name:sister taxa sauger Genbank Taxid: Group:Fish Habitat:Freshwater Status:Threatened Gene Region:CYTB Fragment Length:112 qPCR Chemistry:Probe Forward Primer:TGGGGTCATCCTCCTTCTRAT Reverse Primer:TGCAGATAAGAGGTTAGTAATGACGGTA Probe:FAM-TTTGTAGGGTATGTATTACCCTGA-MGBNFQ PCR Efficiency:95.78 R2: Limit of Detection:10 mtDNA copies per reaction. Limit of Quantification:N/A Journal:PLOS One Source: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0176459 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast