Details

Micropterus dolomieu Smallmouth Bass

Genus:

Micropterus

Species:

dolomieu

Common Name:

Smallmouth Bass

Genbank Taxid:

147949

Group:

Fish

Habitat:

Freshwater

Status:

Gene Region:

COI

Fragment Length:

173

qPCR Chemistry:

TaqMan

Forward Primer:

ACCATCTTCTCTCTTCATCTTGCG

Reverse Primer:

GCGAGGACTGGGAGCGATAA

Probe:

CCCTGTTTGTTTGGTCCGT

PCR Efficiency:

102.8

R2:

Limit of Detection:

20 molecules per reaction

Limit of Quantification:

Journal:

Ecology and Evolution