Snail 0 comments Details Genus:Austropeplea Species:tomentosa Common Name:Snail Genbank Taxid: Group:Mollusc Habitat:Freshwater Status:N/A Gene Region:ITS-2 Fragment Length:118 qPCR Chemistry:Probe Forward Primer:GCCAAATTTTCCTCCTCGT Reverse Primer:AAGCGAGCGTCAGCGTAA Probe:CTAACGGGCCCGCTCGTAACA PCR Efficiency:90 R2: Limit of Detection:50 ng Limit of Quantification:N/A Journal:Veterinary Parasitology Source: https://www.sciencedirect.com/science/article/pii/S0304401718302589?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
