Snake fungal disease 0 comments Details Genus:Ophidomyces Species:ophiodiicola Common Name:Snake fungal disease Genbank Taxid: Group:N/A Habitat:N/A Status:N/A Gene Region:COI Fragment Length:N/A qPCR Chemistry:Probe Forward Primer:TGTTTCTGTCTCGCTCGAAGAC Reverse Primer:AGGTCAAACCGGAAAGAATGG Probe:CGATCGGGCGCCCGTCGTC PCR Efficiency:N/A R2: Limit of Detection:1×10−7 ng/µl. Limit of Quantification:N/A Journal:Conservation Genetics Resources Source: https://doi.org/10.1007/s12686-018-1053-9 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.