sockeye salmon 0 comments Details Genus:Oncorhynchus Species:nerka Common Name:sockeye salmon Genbank Taxid: Group:Fish Habitat:Freshwater/Marine Status:Native Gene Region:COIII Fragment Length:70 qPCR Chemistry:Probe Forward Primer:TCTGCCCTTCTCCTTACGATTTT Reverse Primer:GTTCGACCTAGAAATCGCCCTT Probe:CCATCCTGTTCCTCCT PCR Efficiency:86.08 R2: Limit of Detection:9.38 copies/reaction at ct=35.884 Limit of Quantification:N/A Journal:Biological Conservation Source: https://www.sciencedirect.com/science/article/pii/S0006320717313277?via%3Dihub Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.