Details

Oncorhynchus nerka Sockeye

Genus:

Oncorhynchus

Species:

nerka

Common Name:

Sockeye

Genbank Taxid:

8023

Group:

Fish

Habitat:

Anadromous

Status:

Gene Region:

COI

Fragment Length:

152

qPCR Chemistry:

TaqMan

Forward Primer:

GGAAACCTTGCCCACGCG

Reverse Primer:

AAAAGTGGGGTCTGGTACTGAG

Probe:

FAM‐CTCTGTTGACTTAACCATC‐MGB

PCR Efficiency:

R2:

Limit of Detection:

Limit of Quantification:

Journal:

Molecular Ecology Resources