Sockeye 0 comments Details Oncorhynchus nerka Sockeye Genus: Oncorhynchus Species: nerka Common Name: Sockeye Genbank Taxid: 8023 Group: Fish Habitat: Anadromous Status: Gene Region: COI Fragment Length: 152 qPCR Chemistry: TaqMan Forward Primer: GGAAACCTTGCCCACGCG Reverse Primer: AAAAGTGGGGTCTGGTACTGAG Probe: FAM‐CTCTGTTGACTTAACCATC‐MGB PCR Efficiency: – R2: – Limit of Detection: – Limit of Quantification: – Journal: Molecular Ecology Resources Source: Levi et al. 2019 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment Name * Email * Website Save my name, email, and website in this browser for the next time I comment.