Southeast liver fluke 0 comments Details Genus:Opisthorchis Species:viverrini Common Name:Southeast liver fluke Genbank Taxid: Group:Parasite Habitat:Parasite Status: Gene Region:COI Fragment Length:≈103 qPCR Chemistry:Probe Forward Primer:GCTGGATTTGGGCACCG Reverse Primer:AGTACCCGCAAGCATATACAACC Probe:TAGCTCGGTTACTATGATTAT PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Acta Tropica Source: http://www.sciencedirect.com/science/article/pii/S0001706X16305563 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
