Spikedace 0 comments Details Genus:Meda Species:fulgida Common Name:Spikedace Genbank Taxid: Group:Fish Habitat:Freshwater Status:Endangered Gene Region:CYTB Fragment Length:83 qPCR Chemistry:Probe Forward Primer:GTAGCGGACGTACTTATTCTTACCTGA Reverse Primer:AAAGTATAACAGGGATGCGATTTGTC Probe:GAACACCCATATGTCGC PCR Efficiency:91.7 R2: Limit of Detection:10 mtDNA copies/rxn Limit of Quantification:N/A Journal:PLoS ONE Source: https://doi.org/10.1371/journal.pone.0162200 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
