spotted gar 0 comments Details Genus:Lepisosteus Species:oculatus Common Name:spotted gar Genbank Taxid: Group:Fish Habitat:Freshwater Status:Threatened Gene Region:COI Fragment Length:61 qPCR Chemistry:Probe Forward Primer:CTGACTTCTCCCACCCTCATTT Reverse Primer:CGGCCCCTGCTTCAATC Probe:(6FAM-TTCTCCTTTTAGCCTCATC-MGBNFQ)], PCR Efficiency:N/A R2: Limit of Detection:10 DNA copies/5 μL Limit of Quantification:10 DNA copies/5 μL Journal:Freshwater Ecosystem Source: https://doi.org/10.1002/aqc.2617 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.