Striped Bass Details Genus:Morone Species:saxatilis Common Name:Striped Bass Genbank Taxid: Group:Fish Habitat:Brackish Status:Threatened Gene Region:COI Fragment Length:<150 qPCR Chemistry:Probe Forward Primer:TCCCCGAATGAACAACATAAGTT Reverse Primer:GAAGCTAGAAGGAGGAGGAAGGA Probe:Probe-TTGACTGCTTCCCCC PCR Efficiency:100 R2: Limit of Detection:0.64 pg/μL Limit of Quantification:N/A Journal:Molecular Ecology Resources Source: https://doi.org/10.1111/1755-0998.12305 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast