tadpole shrimp 0 comments Details Genus:Lepidurus Species:apus Common Name:tadpole shrimp Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Thretened/Endangered Gene Region:COI Fragment Length:85 qPCR Chemistry:Probe Forward Primer:TCGGATCCCCTTGTTTGTATG Reverse Primer:AGTGATGGCTCCTGCAAGGA Probe:TCTGTAGCAATCACAGCAT PCR Efficiency:80-100 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Molecular Ecology Source: https://onlinelibrary-wiley-com.proxy.lib.umich.edu/doi/full/10.1111/j.1365-294X.2011.05418.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.