Details

Genus:

Opsariichthys

Species:

uncirostris uncirostris

Common Name:

Three-lips (Fish)

Genbank Taxid:

Group:

Fish

Habitat:

freshwater

Status:

endangered/threatened

Gene Region:

D-loop

Fragment Length:

129

qPCR Chemistry:

Probe

Forward Primer:

CATTTCCTTGCCAGGCTTAATAATA

Reverse Primer:

GCAAAAGGGGGCATATATATAAGAGA

Probe:

CATATGTTTATCTCATGTGCATAAC

PCR Efficiency:

67.2%ā€“82.4%

R2:

Limit of Detection:

N/A

Limit of Quantification:

N/A

Journal:

Ecology and Evolution