Details

Genus:

Trichechus

Species:

manatus

Common Name:

West Indian manatee

Genbank Taxid:

Group:

Mammal

Habitat:

Saltwater

Status:

Vulnerable

Gene Region:

CYTB

Fragment Length:

69

qPCR Chemistry:

Probe

Forward Primer:

CGCTAACCGCATTCTCTTCAG

Reverse Primer:

GGT AGC GAA TGA TYCAAC CAT AGT TTAACCGCATTCTCTTCAG

Probe:

(5ā€™-CCC ACA TTT GCC GAGAC-3ā€™)TAACCGCATTCTCTTCAG

PCR Efficiency:

90-110%

R2:

Limit of Detection:

copy number of 13 molecules Ī¼lāˆ’1

Limit of Quantification:

N/A

Journal:

Endangered Species Research