western toad 0 comments Details Genus:Anaxyrus Species:boreas Common Name:western toad Genbank Taxid: Group:Amphibian Habitat:Wetland Status:Endangered Gene Region:COI Fragment Length:111 qPCR Chemistry:Probe Forward Primer:CAAGAAAGAACCATTYGGGTACATG Reverse Primer:TCGACATTAAGATCTGTCGTAAATATGTG Probe:AATGTCTATTGGTCTTCTAGGGT PCR Efficiency:96.1 R2: Limit of Detection:N/A Limit of Quantification:10 mitochondrial DNA copies/reaction Journal:Global Ecology and Conservation Source: https://doi.org/10.1016/j.gecco.2018.e00438 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.