white-clawed crayfish 0 comments Details Genus:Austropotamobius Species:pallipes Common Name:white-clawed crayfish Genbank Taxid: Group:Crustacean Habitat:Freshwater Status:Thretened/Endangered Gene Region:16S Fragment Length:83 qPCR Chemistry:Dye Forward Primer:AGTTACTTTAGGGATAACAGCGT Reverse Primer:CTTTTAATTCAACATCGAGGTCG Probe:N/A PCR Efficiency:93.8 R2: Limit of Detection:0.005 ng/μl Limit of Quantification:N/A Journal:Biological Conservation Source: https://www.biorxiv.org/content/10.1101/291856v1.full Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.