White Sturgeon Details Genus:Acipenser Species:transmontanus Common Name:White Sturgeon Genbank Taxid: Group:Fish Habitat:Freshwater/Saltwater Status:Native Gene Region:CYTB Fragment Length:<150 qPCR Chemistry:Probe Forward Primer:CCCCGTTTGCATGAATGTTT Reverse Primer:CGCCCACATCTGCCGAGAT Probe:ATTAGTCATCCGTAATTCA PCR Efficiency:101 R2: Limit of Detection:0.026 pg/μL Limit of Quantification:N/A Journal:Journal of Fish and Wildlife Management Source: https://doi.org/10.3996/012018-JFWM-006 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast