Wild Pig 0 comments Details Genus:Sus Species:scrofa Common Name:Wild Pig Genbank Taxid: Group:other Habitat:other Status:Invasive Gene Region:D-loop Fragment Length:101 qPCR Chemistry:Probe Forward Primer:CAAGCATTCCATTCGTATG Reverse Primer:CGCATATTTGTATGTTTGTG Probe:AAACCAAAACGCCAAGTACTTAATTAC PCR Efficiency:90-110 R2: Limit of Detection:1 copy/ul Limit of Quantification:N/A Journal:BMC Research Notes Source: https://bmcresnotes.biomedcentral.com/articles/10.1186/s13104-016-2104-5 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
