zebra mussel 0 comments Details Genus:Dreissena Species:polymorpha Common Name:zebra mussel Genbank Taxid: Group:mussel Habitat:freshwater/brackish Status:invasive Gene Region:CYTB Fragment Length:114 qPCR Chemistry:Probe Forward Primer:CATTTTCTTATACCTTTTATTTTATTAGTGCTTTT Reverse Primer:CGGGACAGTTTGAGTAGAAGTATCA Probe:TAGGTTTTCTTCATACTACTGGC PCR Efficiency:90.22 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Management of Biological Invasions Source: https://doi.org/10.3391/mbi.2017.8.3.03 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.