zebra mussel / quagga mussel Details Genus:Dreissena Species: Common Name:zebra mussel / quagga mussel Genbank Taxid: Group:mussel Habitat:freshwater/brackish Status:invasive Gene Region:16S Fragment Length:139 qPCR Chemistry:Probe Forward Primer:TGGGGCAGTAAGAAGAAAAAAATAA Reverse Primer:CATCGAGGTCGCAAACCG Probe:CCGTAGGGATAACAGC PCR Efficiency:89.19 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Management of Biological Invasions Source: https://doi.org/10.3391/mbi.2017.8.3.03 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast