Zebrafish 0 comments Details Genus:Danio Species:rerio Common Name:Zebrafish Genbank Taxid: Group:Fish Habitat:Freshwater Status:Native Gene Region:Glyceraldehyde-3-phosphate dehydrogenase Fragment Length: qPCR Chemistry:Dye Forward Primer:CGCTGGCATCTCCCTCAA Reverse Primer:TCAGCAACACGATGGCTGTAG Probe:N/A PCR Efficiency:N/A R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:Acta Biochimica et Biophysica Sinica Source: https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1745-7270.2007.00283.x Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.