Zuni Bluehead Suckers 0 comments Details Genus:Catostomus Species:discobolus yarrowi Common Name:Zuni Bluehead Suckers Genbank Taxid: Group:Fish Habitat:Freshwater Status:Thretened/Endangered Gene Region:ND2 Fragment Length:246 qPCR Chemistry:Probe Forward Primer:GTTGCCACTACTGCCTTGGT Reverse Primer:CAGTTGAGTGGATCGGGTTC Probe:AGTGACTAATTCTGCAAGAACTAGCTAAACAG PCR Efficiency:91 R2: Limit of Detection:N/A Limit of Quantification:N/A Journal:North American Journal of Fisheries Management Source: https://www.tandfonline.com/doi/full/10.1080/02755947.2017.1306005 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.