southern corroboree frog 0 comments Details Genus:Pseudophryne Species:corroboree. Common Name:southern corroboree frog Genbank Taxid: Group:Amphibian Habitat:Freshwater Status:Thretened/Endangered Gene Region:ND4 Fragment Length:155 qPCR Chemistry:Probe Forward Primer:GGAGTCAAATCATCCTCCCAC Reverse Primer:TAAAGCTGCTAAGACAAGTGAGA Probe:ACCCCCATCAACCAACTTCA PCR Efficiency:90 R2: Limit of Detection:100 copies ul^-1 Limit of Quantification:N/A Journal:Wildlife Research Source: https://www.publish.csiro.au/wr/WR17180 Primer-Blast: Search this item on the National Center for Biotechnology Information Primer-Blast Submit a Comment Cancel replyYour email address will not be published. Required fields are marked *Comment * Name * Email * Website Save my name, email, and website in this browser for the next time I comment.
