Database

Filter


Text Search

Genus Common Name Gene Region Fragment Length Forward Primer Reverse Primer Probe PCR Efficiency
Coregonus broad whitefish COI or cytb? 146 TCGATCCCTAACAAACTAGGC TCTGCTACTAGGGTTCAGAATAGGAA FAM‐TATTCTACACACCTCTAAGCAG‐MGB‐NFQ
Dikerogammarus COI 117 5’ – GGAGCTTCCTCTATTCTTGGCGCAATT – 3’ 5’ – GGCCGTGATAAAGACAGACCAGACAAA – 3’ 6–FAM – TTCTTAATATGCGCGCCCCAGGC – BHQ–1 90.341
Dreissena Dreissenids 16S 139 CAT TTT CTT ATA CCT TTT ATT TTA TTA GTG CTT TT CGG GAC AGT TTG AGT AGA AGT ATC A FAM–TAG GTT TTC TTC ATA CTA CTG GC–MGBNFQ 89.19
Dreissena Zebra Mussel Cytb 114 SCC TGC GAT AGA TTT TTT GAT TTT A GCA GAA CAA AGG GAC CCG NED–CGT GCT GGA TGT CAT–MGBNFQ 90.22
Dreissena Zebra Mussel COI 136 TGGGGCAGTAAGAAGAAAAAAATAA CATCGAGGTCGCAAACCG VIC–CCGTAGGGATAACAGC–MGBNFQ 84.36
Egeria Brazilian elodea ITS1–5.8s–ITS2 79 5′–GGTCAATGGCAATTCCTTCTTG–3′ 5′–GCGCACCACCCAAATAGA–3′ 6FAM–5′–CCATGCCCAATGAGAGTCGCGTAT–3′ 96.25
Engraulis Japanese anchovy Cytb 115 GAAAAACCCACCCCCTACTCA GTGGCCAAGCATAGTCCTAAAAG FAM–CGCAGTAGTAGACCTCCCAGCACCATCC–TAMRA 0.90–0.95
Etheostoma Fantail Darter Cytb 118 AAGCGAAGAAGCGAGTTAGG GGTGCTACGGTCATCACTAATC FAM–CCCACATAA/ZEN/GGCACTGCAGAGAGT/3IABkFQ 97.2
Halichoeres Wrasse Cytb 113 CGCAGACGTTGTAGTCCTCACA GTGAGAAGACTAGGAATAGTATAAAGTAGATGATG FAM–CCGTACGTAATTATTGGCCAAATCGCG–TAMRA 0.94–0.95
Isogenus COI 124 5′–CCAGAAGCCTTGTAGAAAAC–3′ 5′–ACCCCGGCTAGATGAAGAGA–3′ 6–FAM–CCCCACTCTCTGCTGGAATT–BHQ–1
Micropterus Smallmouth Bass COI 173 ACCATCTTCTCTCTTCATCTTGCG GCGAGGACTGGGAGCGATAA CCCTGTTTGTTTGGTCCGT 102.8
Misgurnus European weather loach COI 119 CCCCCGACATAGCATTTCCG AACTGTTCAGCCTGTCCCAG (6‐FAM)CTCGTTCCTCCTTCTGCTGG(ZEN/IBFQ)
Mylopharyngodon Black carp CO3 100 ACAAGCTATCCAATCCCTTGCA GTCTGCGATTGTAAAGGGTGC ACTGGGACTTTACTTCACTGCT 96.5–102.8
Mylopharyngodon Black carp CO1 120 ACACCACGTTCTTTGACCCA GTGAAATGATCCCAAACCCGG ATTCTTCGGCCACCCAGAAG 93.9–104.3
Mylopharyngodon Black carp ND2 120 CGGAGGATGAGGGGGACTAA GCGACTAGGGTGAGTTGTGG GCTTACTCCTCAATCGCCCA 99.8–117.2
Mylopharyngodon Black carp ND2 120 TGGCTTACTCCTCAATCGCC GGGTTAGGAATGCTGCGGAT ACTCACCCTAGTCGCCCTAG 99.6–104.6
Oncomelania COI 187 GCATGTGAGCGGGGCTAGTA AAGCGGAACCAATCAGTTGCC 5’–FAM–GTGCAGAGTTAGGTCAGTCCT–MGB–NFQ–3’
Oncorhynchus Coho COI 95 CGCTCTTCTAGGGGATGATC CTCCGATCATAATCGGCATG FAM‐ATTTACAACGTAATCGTC‐MGB
Oncorhynchus Sockeye COI 152 GGAAACCTTGCCCACGCG AAAAGTGGGGTCTGGTACTGAG FAM‐CTCTGTTGACTTAACCATC‐MGB
Oncorhynchus Coho COIII/ND3 CCTTTCTAGCCGTTTGCCTTCT CAGCTTCAAAGCCAAAATGATGTTC 5’ VIC– AAGTGGTATTGGACCTGTCG–NFQ